Home > Parent Resources > Genetics of Rett Syndrome

Genetics of Rett Syndrome

Table of Contents



Genetics Primer

Cells are the fundamental working units of every living system. All the instructions needed to direct their activities are contained within the DNA that resides in the cell’s nucleus.
1
DNA from all organisms, from the tiniest bacteria to humans, is made up of the same chemical and physical components. The DNA is organized like a twisted ladder with bonds between the rungs that can be “unzipped” like a zipper.  The rungs are made up of nucleotide bases called A,C,T, and G. A always pairs with T and C always pairs with G. This order spells out the exact instructions required to create a particular organism with its own unique traits.
The genome is an organism’s complete set of DNA. Genomes vary widely in size: the smallest known genome for a free-living organism (a bacterium) contains about 600,000 DNA base pairs, while human and mouse genomes have some three billion. Each human cell contains a complete genome.
DNA in the human genome is arranged into 24 chromosomes, each containing many genes.  The X and Y chromosomes determine the sex of a baby. Girls have two X chromosomes and no Y, and boys have one X and one Y. The MECP2 gene is located on the X chromosome. Girls with RTT therefore have two MECP2 genes, one that is mutated and one that is normal.
Although genes get a lot of attention, it’s the proteins they encode that perform most life functions and even make up the majority of cellular structures. Proteins are large, complex molecules made up of many subunits called amino acids. Chemical properties that distinguish the 20 different amino acids cause the protein chains to fold up into specific three-dimensional structures, which define their particular functions in the cell.

A single strand of DNA is made of letters:
ATGCTCGAATAAATGTGAATTTGA
Every 3 letters make up a word, also known as amino acids. Many words together make up a gene. The MeCP2 protein is made up of almost 500 amino acids.
ATG CTC GAA TAA ATG TGA ATT TGA




What does my child’s mutation mean?

A gene mutation is a permanent change in the DNA sequence. Mutations range in size from only one nucleotide base to a large segment of DNA comprising many genes.

By changing a gene's instructions for making a protein, a mutation can cause the protein to malfunction or to be missing entirely. In RTT a mutation in the MECP2 gene causes the MeCP2 protein to be mutated as well.

It is important to note that genes themselves do not cause disease--genetic disorders are caused by mutations that make a gene function improperly. For example, when people say that someone has "the Rett Syndrome gene," they are referring to a mutated version of the MECP2 gene, which causes the disorder. All people, including those without RTT, have a normal MECP2 gene.

Your child’s results usually contain two pieces of information – a number that refers to which nucleotide base is mutated, and a number that corresponds to the resulting change in the amino acid sequence.

You may also be told that the mutation is heterozygous, meaning your daughter has one normal X chromosome and one X chromosome with a mutated MECP2. Boys with MECP2 mutations are homozygous because they only have one X chromosome. Below are some examples of typical mutations.

Missense mutation
This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another.

Example
473 C --> T  /  T158M

The first number refers to the nucleotide base that is mutated. In this particular case, at nucleotide base number 473 there should have been a cytosine nucleotide base, but due to the mutation there is now a thymine.

This results in a different amino acid being encoded. At amino acid number 158 (divide 473 by 3 to get the amino acid number since every 3 bases encodes for an amino acid)  there should have been a Threonine but there is now a Methionine. This simple change of only one amino acid out of almost 500 amino acids makes the protein dysfunctional.

Nonsense mutation
A nonsense mutation is also a change in one DNA base pair. Instead of substituting one amino acid for another, however, the altered DNA sequence prematurely signals the cell to stop building a protein. This type of mutation results in a shortened protein that may function improperly or not at all.

Example
R168X

The X denotes a mutation that results in a prematurely truncated protein.

Insertion
An insertion changes the number of DNA bases in a gene by adding a piece of DNA resulting in a dysfunctional protein.

Example
620insT

At nucleotide base number 620 an extra thymine was inserted.

Deletion
A deletion changes the number of DNA bases in a gene by removing a piece of DNA. The deleted DNA alters the function of the resulting protein.

Example
803del4

At nucleotide base number 803, four bases were deleted.

Frameshift mutation
This type of mutation occurs when the addition or loss of DNA bases changes a gene's reading frame. A reading frame consists of groups of 3 bases that each code for one amino acid. A frameshift mutation shifts the grouping of these bases and changes the code for amino acids. The resulting protein is usually non-functional. Insertions, deletions, and duplications can all be frameshift mutations. The 620insT and 803del4 examples above both result in frameshift mutations.

Frequency of Common Mutations

2





Can I predict my child’s symptoms from the mutation?

One variable that plays a role in symptom severity is X inactivation. Females have two X chromosomes, while males have one. In order for males and females to have the same amount of genetic material, females must silence one of their X chromosomes in every cell. Most females have a random inactivation pattern which activates roughly 50% of one X and 50% of the other. However, for reasons unknown it can happen that a female will skew one X over the other.

If a girl with RTT favors inactivation of the X chromosome with the mutated MECP2 she will have less severe symptoms. If the reverse happens the child may have more severe symptoms. Although it is possible to have your daughter’s X inactivation pattern in her blood tested this will not tell you what the pattern is in her brain, so the usefulness of this test is very limited.

A number of studies attempting to correlate specific mutations to symptoms have yielded, to date, inconsistent results. Some very general conclusions include:

  • The R133C mutation is typically mild
  • Truncating mutations appear to correlate with breathing abnormalities whereas scoliosis was more common in individuals with missense mutations
  • Missense mutations appear to cause milder symptoms
  • Early truncating mutations have a more severe outcome then late truncating or missense mutations

It’s important to note that these are generalizations based on large sample sizes. Drawing conclusions regarding your child’s mutation on a case-by-case basis is not reliably predictive.  Furthermore, we do not know what other factors including environmental influences mediate the effects of a specific mutation.

3




Where did the mutation come from?

The vast majority of mutations are sporadic, not familial, and originate from a mutated sperm. In such cases a father, if tested for MECP2 mutations, will test negative since he does not have mutations in any of his cells except for the particular sperm which fertilized the egg that resulted in his daughter.

4

In families where MECP2 mutations have been identified in more than one family member there are two possible explanations.

  • The mother has an MECP2 mutation but has favorably skewed her X inactivation pattern so she is asymptomatic.
  • The mother has mutations in her eggs, but in no other tissue. She is therefore completely symptom free but has a 50% chance of passing the mutation on to her offspring. This is called germline mosaicism.




Can Males Have Rett Syndrome?

Although rare, males can have mutations in MECP2.  There are three scenarios which may lead to males with RTT.

  • A boy has Klinefelter Syndrome (which happens in 1 in 1,000 male births) and is born with an extra X chromosome (XXY). One of the X's has the mutation and the other does not. These boys will have symptoms similar to girls with RTT.
  • A mutation derives not from the sperm or the egg but rather at a slightly later stage, such as the 20-cell stage (blastula). If one cell becomes mutated, every cell downstream to it will also mutate, while the remaining 19 cells and all cells that originate from them will not. This is called somatic mosaicism and the phenotype will resemble a girl with RTT, since the somatic mosaicism will function similarly to X inactivation patterns in girls.
  • A boy is born with a typical XY karotype and has mutations in MECP2 on all of his X chromosomes. Since he has no healthy copy to mitigate the mutated gene his symptoms will be very severe and likely lead to early death. However, for reasons not yet understood, there are some boys with "milder" mutations.

Interestingly, a recent scientific article described a group of males who have two copies of MECP2 on their X chromosome, thus they have too much MeCP2 protein being produced. The boys’ symptoms included: hypotonia, developmental delay, no speech or ambulation, seizures, recurrent infections and spasticity as the child aged. In these cases the duplications of the MECP2 gene came from mothers who for unknown reason were all asymptomatic, with extremely skewed X inactivation.

5




Should Family Members be tested?

Testing parents, siblings and other relatives is a personal decision that each family must make. Family planning decisions can significantly influence whether parents should be tested.

Parents of a daughter with an MECP2 mutation

The vast majority (99.5%) of cases of RTT are single occurrences in a family resulting from a sporadic mutation in a single sperm. Parents tested for MECP2 mutations almost always test negative.

In rare cases, however, the mutation comes from the mother’s eggs. Either of two scenarios could occur.

  • The mother’s eggs could have the mutation, known as germline mosaicism. An offspring would have a 50% chance of inheriting the mutation from its mother.
  • The mother has the mutation in every cell but due to favorable X inactivation skewing she does not have RTT symptoms. Again, an offspring would have 50% chance of inheriting the mutation from its mother.

Testing the mother through a blood test would rule out skewed X inactivation but the only way to detect germline mosaicism is by analyzing the eggs.

Parents of a son with an MECP2 mutation

  • The father of an affected son does not need to be tested since boys inherit the mutated MECP2 gene from their mothers.
  • The mother’s eggs could have the mutation, known as germline mosaicism. An offspring would have a 50% chance of inheriting the mutation from its mother.
  • The mother has the mutation in every cell but due to favorable X inactivation skewing she does not have RTT symptoms. Again, an offspring would have 50% chance of inheriting the mutation from its mother.

Testing the mother through a blood test would rule out skewed X inactivation but the only way to detect germline mosaicism is by analyzing the eggs.

Siblings of a child with RTT

The risk to siblings depends upon the genetic status of the parents.

  • When the mother of an affected individual is found to have the MECP2 mutation identified in her affected child, the risk to siblings of inheriting the mutation is 50%.
  • If a mutation is not identified in a parent, the risk to siblings is low. However, germline mosaicism cannot be excluded.

67

8

Prenatal Testing

Prenatal testing is available for parents who have a child with an identified MECP2 mutation. Prenatal testing is possible by analysis of DNA obtained by amniocentesis usually obtained at about 15-18 weeks' gestation or chorionic villus sampling (CVS) at about 10-12 week’s gestation.





My child tested negative…now what?

Mutations have been found in about 90% of individuals with a clinical diagnosis of RTT. What could be going on in the remaining 10%?

  • Analyzing the MECP2 gene typically involves a 2-step process. Picture the MECP2 gene as a book with 4 chapters. Mutations may include having a missing page(s), an extra page(s) or pages in the wrong order. Identifying these types of mutations is done by sequencing the gene. In some cases an entire chapter or two chapters may be missing. The correct term for the chapters is exons. Identifying missing exons is called deletion analysis. If your child has tested negative via sequencing we encourage you to also have the deletion testing done since about 10% of all RTT cases are due to exonic deletions. Check with your doctor to see whether exonic deletion testing has been performed. Check the RSRF website for a list of labs that perform this test.
  • MECP2, like all other genes, is made up of coding regions (areas that code for proteins) and non-coding regions. While the coding regions of MECP2 are known and can be checked for mutations the non-coding regions are not. If your child has a mutation in a non-coding area it would not be possible, at this time, to detect it.
  • It is also possible that mutations may exist in genes, as yet unidentified, that work in concert with MECP2.
  • Mutations in a gene called CDKL5 (also known as STK9) have recently been associated with a Rett-like presentation with early onset seizures. If your child has tested negative for an MECP2 mutation, presents with RTT symptoms and had early onset seizures we suggest you have your child tested for a CDKL5 mutation.  Please check the RSRF website for a listing of labs.